Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Expression of EGFRvIII as a fraction of total EGFR is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, TaqMan Assay

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Comparison with orthogonal platforms a EGFRvIII vs. total EGFR as determined by Nanostring is plotted. EGFRvIII expression was determined independently from TCGA RNA-seq analysis (RNAS). Red denotes cases with >10 % TAF by RNAS, green 1–10 % and blue <1 %. Black circles filled with gray mark cases where no RNAS reads identified EGFRvIII; empty circles mark cases for which RNA-seq data were unavailable. b EGFRvIII expression was compared with genomic loss of EGFR exons 2–7 in 157 cases for which both RNA and DNA (exome) sequencing data were available. Samples are ordered by the magnitude of exon 2–7 deletion inferred from DNA seq coverage. Expression was determined by the ratio of VIII junction RPKM to total EGFR

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Comparison, Expressing, RNA Sequencing, Sequencing, DNA Sequencing

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Performance of Nanostring assay applied to suboptimal material. Counts of EGFR-WT ( a ) and EGFRvIII ( b ) are correlated between patient-matched samples maintained by optimal, flash-frozen, and suboptimal, versus formalin-fixed paraffin-embedded samples ( FFPE ), preservation methods. c Concordance of NS assay as a binary classifier from FFPE and frozen material

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Formalin-fixed Paraffin-Embedded, Preserving

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Genomic and clinical correlates of EGFRvIII expression. a Significant EGFRvIII expression is exclusively found in tumors with amplification of EGFR. NS counts of EGFRvIII expression are plotted with respect to kinase domain counts. Blue circles denote samples with EGFR point mutation. Red denotes tumors with high-level amplification of the EGFR locus (aCGH log2 ratio >2). For two samples with high EGFRvIII expression, but log2 ratios below 2 ( red arrows ), aCGH demonstrates focal CNA in a pattern consistent with high-level gene amplification in a subpopulation of cells (and demonstrated by FISH for one of the two cases ). b Association between EGFR status and transcriptomal subclass. c Overall survival of patients stratified by EGFRvIII status. d Overall survival of patients stratified by EGFRvIII status excluding G-CIMP tumors, which are known to have a more favorable prognosis

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Amplification, Mutagenesis

Journal: Acta Neuropathologica

Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates

doi: 10.1007/s00401-013-1217-3

Figure Lengend Snippet: Molecular context of EGFR alterations in GBM. From top to bottom EGFR mRNA expression, DNA copy number, deletion mutation expression, transcriptomal and methylation subclass are reported for each sample

Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan ABI Gene expression Assays Hs01076076_m1).

Techniques: Expressing, Mutagenesis, Methylation