|
Roche
kapa library quantification dna standards illumina roche Kapa Library Quantification Dna Standards Illumina Roche, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kapa library quantification dna standards illumina roche/product/Roche Average 99 stars, based on 1 article reviews
kapa library quantification dna standards illumina roche - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
type i gibco Type I Gibco, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/type i gibco/product/Thermo Fisher Average 99 stars, based on 1 article reviews
type i gibco - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
am1561 truseq dna nano kit illumina Am1561 Truseq Dna Nano Kit Illumina, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/am1561 truseq dna nano kit illumina/product/Illumina Inc Average 99 stars, based on 1 article reviews
am1561 truseq dna nano kit illumina - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Illumina Inc
a32992 truseq dna pxr dree high throughput library prep kit A32992 Truseq Dna Pxr Dree High Throughput Library Prep Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/a32992 truseq dna pxr dree high throughput library prep kit/product/Illumina Inc Average 96 stars, based on 1 article reviews
a32992 truseq dna pxr dree high throughput library prep kit - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Qiagen
dna/rna/mirna universal kit Dna/Rna/Mirna Universal Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna/rna/mirna universal kit/product/Qiagen Average 90 stars, based on 1 article reviews
dna/rna/mirna universal kit - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
New England Biolabs
e7645s miseq reagent kit v3 E7645s Miseq Reagent Kit V3, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/e7645s miseq reagent kit v3/product/New England Biolabs Average 99 stars, based on 1 article reviews
e7645s miseq reagent kit v3 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
r2050 protoscript ii first strand cdna synthesis kit new england biolabs R2050 Protoscript Ii First Strand Cdna Synthesis Kit New England Biolabs, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/r2050 protoscript ii first strand cdna synthesis kit new england biolabs/product/New England Biolabs Average 97 stars, based on 1 article reviews
r2050 protoscript ii first strand cdna synthesis kit new england biolabs - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Thermo Fisher
tris hcl thermo fisher 15 568 025 rnase outtm thermo fisher 10777019 iscript advanced reaction mix Tris Hcl Thermo Fisher 15 568 025 Rnase Outtm Thermo Fisher 10777019 Iscript Advanced Reaction Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tris hcl thermo fisher 15 568 025 rnase outtm thermo fisher 10777019 iscript advanced reaction mix/product/Thermo Fisher Average 99 stars, based on 1 article reviews
tris hcl thermo fisher 15 568 025 rnase outtm thermo fisher 10777019 iscript advanced reaction mix - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
New England Biolabs
assays qiaquick pcr purification qiagen 28106 nebnext ultratm ii dna library prep kit new england biolabs e7103 bicinchoninic acid bca Assays Qiaquick Pcr Purification Qiagen 28106 Nebnext Ultratm Ii Dna Library Prep Kit New England Biolabs E7103 Bicinchoninic Acid Bca, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/assays qiaquick pcr purification qiagen 28106 nebnext ultratm ii dna library prep kit new england biolabs e7103 bicinchoninic acid bca/product/New England Biolabs Average 97 stars, based on 1 article reviews
assays qiaquick pcr purification qiagen 28106 nebnext ultratm ii dna library prep kit new england biolabs e7103 bicinchoninic acid bca - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
Illumina Inc
20022370 truseq stranded total rna library prep gold 20022370 Truseq Stranded Total Rna Library Prep Gold, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/20022370 truseq stranded total rna library prep gold/product/Illumina Inc Average 96 stars, based on 1 article reviews
20022370 truseq stranded total rna library prep gold - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
gene exp egfr hs01076076 m1 ![]() Gene Exp Egfr Hs01076076 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene exp egfr hs01076076 m1/product/Thermo Fisher Average 86 stars, based on 1 article reviews
gene exp egfr hs01076076 m1 - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
|
Qiagen
reverse transcriptase quantitative polymerase chain reaction rt qpcr mirnas ![]() Reverse Transcriptase Quantitative Polymerase Chain Reaction Rt Qpcr Mirnas, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse transcriptase quantitative polymerase chain reaction rt qpcr mirnas/product/Qiagen Average 96 stars, based on 1 article reviews
reverse transcriptase quantitative polymerase chain reaction rt qpcr mirnas - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Neuropathologica
Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates
doi: 10.1007/s00401-013-1217-3
Figure Lengend Snippet: Expression of EGFRvIII as a fraction of total EGFR is quantified by Nanostring assay and qRT-PCR in 189 GBMs. a Expression of EGFRvIII (exon 1–8 junctional probe) is shown as a function of EGFR kinase domain ( KD ), determined by normalized Nanostring ( NS ) counts. Expression levels are classified as high [ red mutation in >10 % transcribed allelic fraction ( TAF )], intermediate ( orange 1–10 % TAF), marginal ( black <1 % TAF) or negative ( open circles ). These color assignments are carried through panels b – d . b Correlation of EGFRvIII expression between NS and qRT-PCR. Normalized expression levels are plotted for EGFRvIII and KD from the Taqman assay (see “ ”). Samples are colored according to NS expression classification from Fig. 1a. c Cross-platform correlation of EGFRvIII epression, NS vs. qRT-PCR. d Cross-platform correlation of EGFRvIII as a fraction of total EGFR, NS vs. qRT-PCR. e Experimental design of dilution experiment to establish linearity of the Nanostring assay. A sample with high relative expression of EGFRvIII was diluted with a sample negative for EGFRvIII expression, maintaining a constant 250 ng of total RNA in each reaction. f Counts of EGFRvIII and EGFR KD as a function of diluted fraction of EGFRvIII-containing sample
Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan
Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, TaqMan Assay
Journal: Acta Neuropathologica
Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates
doi: 10.1007/s00401-013-1217-3
Figure Lengend Snippet: Comparison with orthogonal platforms a EGFRvIII vs. total EGFR as determined by Nanostring is plotted. EGFRvIII expression was determined independently from TCGA RNA-seq analysis (RNAS). Red denotes cases with >10 % TAF by RNAS, green 1–10 % and blue <1 %. Black circles filled with gray mark cases where no RNAS reads identified EGFRvIII; empty circles mark cases for which RNA-seq data were unavailable. b EGFRvIII expression was compared with genomic loss of EGFR exons 2–7 in 157 cases for which both RNA and DNA (exome) sequencing data were available. Samples are ordered by the magnitude of exon 2–7 deletion inferred from DNA seq coverage. Expression was determined by the ratio of VIII junction RPKM to total EGFR
Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan
Techniques: Comparison, Expressing, RNA Sequencing, Sequencing, DNA Sequencing
Journal: Acta Neuropathologica
Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates
doi: 10.1007/s00401-013-1217-3
Figure Lengend Snippet: Performance of Nanostring assay applied to suboptimal material. Counts of EGFR-WT ( a ) and EGFRvIII ( b ) are correlated between patient-matched samples maintained by optimal, flash-frozen, and suboptimal, versus formalin-fixed paraffin-embedded samples ( FFPE ), preservation methods. c Concordance of NS assay as a binary classifier from FFPE and frozen material
Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan
Techniques: Formalin-fixed Paraffin-Embedded, Preserving
Journal: Acta Neuropathologica
Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates
doi: 10.1007/s00401-013-1217-3
Figure Lengend Snippet: Genomic and clinical correlates of EGFRvIII expression. a Significant EGFRvIII expression is exclusively found in tumors with amplification of EGFR. NS counts of EGFRvIII expression are plotted with respect to kinase domain counts. Blue circles denote samples with EGFR point mutation. Red denotes tumors with high-level amplification of the EGFR locus (aCGH log2 ratio >2). For two samples with high EGFRvIII expression, but log2 ratios below 2 ( red arrows ), aCGH demonstrates focal CNA in a pattern consistent with high-level gene amplification in a subpopulation of cells (and demonstrated by FISH for one of the two cases ). b Association between EGFR status and transcriptomal subclass. c Overall survival of patients stratified by EGFRvIII status. d Overall survival of patients stratified by EGFRvIII status excluding G-CIMP tumors, which are known to have a more favorable prognosis
Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan
Techniques: Expressing, Amplification, Mutagenesis
Journal: Acta Neuropathologica
Article Title: Quantitative assessment of intragenic receptor tyrosine kinase deletions in primary glioblastomas: their prevalence and molecular correlates
doi: 10.1007/s00401-013-1217-3
Figure Lengend Snippet: Molecular context of EGFR alterations in GBM. From top to bottom EGFR mRNA expression, DNA copy number, deletion mutation expression, transcriptomal and methylation subclass are reported for each sample
Article Snippet: 400 ng of total RNA was reverse-transcribed using the Thermoscript RT-PCR system (Invitrogen) at 52 °C for 1 h. 20 ng of resultant cDNA was used in a Q-PCR reaction using an 7500 Real-Time PCR System (Applied Biosystems) and custom-designed TaqMan gene expression Assays (EGFRvIII Forward primer: 5′CGGGCTCTGGAGGAAAAG3′; EGFRvIII reverse primer: 5′AGGCCCTTCGCACTTCTTAC3′; EGFRvIII internal primer: 5′GTGACAGATCACGGCTCGTG3′; total EGFR: pre-designed TaqMan
Techniques: Expressing, Mutagenesis, Methylation